View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4617_low_24 (Length: 227)
Name: NF4617_low_24
Description: NF4617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4617_low_24 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 41747019 - 41746798
Alignment:
| Q |
6 |
aatttcagtgtgcgcaaactacccaataaagaataacgttagaaacacactctttaccacggtctttcttattattagttacaattcataggagtcccac |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
41747019 |
aatttcagtgtgcgcaaactacccaataaagaataacgttagaaacacactctttaccacggtcttttttattattagttacaattcataagagtcccac |
41746920 |
T |
|
| Q |
106 |
caaatttatatgagatttatatgaattttaactaataaaagattgagttataaaatatgtgttgaaccatgttgttaacacttcactcgaataaaatact |
205 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41746919 |
caaatttatatgagatttagatgaattttaactaataaaagattgagttataaaatatgtgttgaaccgtgttgttaacacttcactcgaataaaatact |
41746820 |
T |
|
| Q |
206 |
gttataaagtaaataaattaat |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41746819 |
gttataaagtaaataaattaat |
41746798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 79 - 119
Target Start/End: Original strand, 33029523 - 33029563
Alignment:
| Q |
79 |
attagttacaattcataggagtcccaccaaatttatatgag |
119 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
33029523 |
attagttaaaattcatataagtcccaccaaatttatatgag |
33029563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University