View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4618_low_3 (Length: 307)

Name: NF4618_low_3
Description: NF4618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4618_low_3
NF4618_low_3
[»] chr4 (1 HSPs)
chr4 (17-90)||(48991641-48991714)
[»] chr3 (2 HSPs)
chr3 (223-274)||(6798918-6798970)
chr3 (40-107)||(6798611-6798681)


Alignment Details
Target: chr4 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 17 - 90
Target Start/End: Complemental strand, 48991714 - 48991641
Alignment:
Q  17 attaggatctttgtatgagatgttaaaatgaaggagtgagtgcctcaattataaaattgttgataatccgaaac 90  Q
    ||||||||||||||||||||||||||||||||| |||| |||| |||| || ||||||||||||||||||||||    
T  48991714 attaggatctttgtatgagatgttaaaatgaagaagtgggtgcgtcaactagaaaattgttgataatccgaaac 48991641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 6798918 - 6798970
Alignment:
Q  223 ggtatgaacacttaaaa-agggacacaatgcatagaagtatttctgaacaagg 274  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  6798918 ggtatgaacacttaaaaaagggacacaatgcatagaagtatttctgaacaagg 6798970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 40 - 107
Target Start/End: Original strand, 6798611 - 6798681
Alignment:
Q  40 taaaatgaaggagtgagtgcctcaattataaaattgttgataatccgaaac---aattgcatgagttcttc 107  Q
    |||||| ||| |||| |||||||||||| |||| |||||||||||||||||   |||||||||||||||||    
T  6798611 taaaataaagcagtgggtgcctcaattagaaaactgttgataatccgaaactcaaattgcatgagttcttc 6798681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University