View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4618_low_3 (Length: 307)
Name: NF4618_low_3
Description: NF4618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4618_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 17 - 90
Target Start/End: Complemental strand, 48991714 - 48991641
Alignment:
| Q |
17 |
attaggatctttgtatgagatgttaaaatgaaggagtgagtgcctcaattataaaattgttgataatccgaaac |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||| |||| || |||||||||||||||||||||| |
|
|
| T |
48991714 |
attaggatctttgtatgagatgttaaaatgaagaagtgggtgcgtcaactagaaaattgttgataatccgaaac |
48991641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 6798918 - 6798970
Alignment:
| Q |
223 |
ggtatgaacacttaaaa-agggacacaatgcatagaagtatttctgaacaagg |
274 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6798918 |
ggtatgaacacttaaaaaagggacacaatgcatagaagtatttctgaacaagg |
6798970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 40 - 107
Target Start/End: Original strand, 6798611 - 6798681
Alignment:
| Q |
40 |
taaaatgaaggagtgagtgcctcaattataaaattgttgataatccgaaac---aattgcatgagttcttc |
107 |
Q |
| |
|
|||||| ||| |||| |||||||||||| |||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6798611 |
taaaataaagcagtgggtgcctcaattagaaaactgttgataatccgaaactcaaattgcatgagttcttc |
6798681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University