View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4619-Insertion-10 (Length: 153)
Name: NF4619-Insertion-10
Description: NF4619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4619-Insertion-10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 8 - 153
Target Start/End: Original strand, 10216817 - 10216962
Alignment:
| Q |
8 |
ccaagactgtaatccagttggctcatacattaggctgcatatcatggaagtacccactggtgttgcttcaaagttatgtatactttcaaagacaacaccg |
107 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10216817 |
ccaagactgtattccagttggctcatacattaggctgcatatcatggaagtacccactggtgttgcttcaaagttatgtatactttcaaagacaacaccg |
10216916 |
T |
 |
| Q |
108 |
gttacagcatgtggtctgctcgaacacgaaaacgaagtttctgtcc |
153 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10216917 |
gttacagcatgtggtctgctggaacacgaaaacgaagtttctgtcc |
10216962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 2e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 22 - 121
Target Start/End: Complemental strand, 53887074 - 53886975
Alignment:
| Q |
22 |
cagttggctcatacattaggctgcatatcatggaagtacccactggtgttgcttcaaagttatgtatactttcaaagacaacaccggttacagcatgtgg |
121 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||| |||| || |||||| ||||| ||||||||| || |||||||||| ||| ||||| ||||||| |
|
|
| T |
53887074 |
cagttggctcatatgctaggctgcatatcaaggaagtgcccagtgctgttgcatcaaaattatgtataattgcaaagacaaccccgattacaacatgtgg |
53886975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University