View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4620-Insertion-14 (Length: 218)
Name: NF4620-Insertion-14
Description: NF4620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4620-Insertion-14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 217
Target Start/End: Original strand, 23983025 - 23983224
Alignment:
| Q |
18 |
tgatgacttcattctacatcattgttggacttgtccaaagataggaccatacatgaagcaaaggtttacgtccaatgatatgttaccatatcaattaatg |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23983025 |
tgattacttcattctacatcattgttggacttgtgcaaagataggaccatacatgaagcatatgtttacgtccaatgatatgttaccatatcaattaatg |
23983124 |
T |
 |
| Q |
118 |
ttatatgaccgttttgtttggctgattatggtgttcttctggtggaccgagaatgaggggtgctttctaatttagttctgaagtctggtggatcgatcgt |
217 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||| || ||||||||||||| |||||||| |
|
|
| T |
23983125 |
ttatatgaccgtcttgtttggctggttatggtgttcttctggtggaccgagggtgaggggtgccttctaatttggtcttgaagtctggtgggtcgatcgt |
23983224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University