View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4620_high_2 (Length: 266)
Name: NF4620_high_2
Description: NF4620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4620_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 19474881 - 19474632
Alignment:
| Q |
1 |
agttccttgcggtcttgaattgatcctcgttgtttctctacgatattcgatgttccaacgtcgtggaaaagattcgagagctttgtggtttcggatattg |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19474881 |
agttccttgcagtcttgaattgatcctcgttgtttctctacgatattcgatgttccaacgtcgtggaaaagattcgagagctttgtggtttcggatattg |
19474782 |
T |
|
| Q |
101 |
ctagttgaagtgaatgaagaaggtaggttatgatgtttgggtttatgtttatggatatggaaagttttaatgagttgaaacaaagtttagggtatggtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19474781 |
ctagttgaagtgaatgaagaaggtaggttatgatgtttgggtttatgtttatggatatggaaagttttaatgagttgaaacaaagtttagggtatggtgt |
19474682 |
T |
|
| Q |
201 |
tgttttgcataaagattttaaggaagtgagtttgttgggatttagtgatg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19474681 |
tgttttgcataaagattttaaggaagtgagtttgttgggatttagtgatg |
19474632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 71 - 179
Target Start/End: Complemental strand, 51546918 - 51546810
Alignment:
| Q |
71 |
gattcgagagctttgtggtttcggatattgctagttgaagtgaatgaagaaggtaggttatgatgtttgggtttatgtttatggatatggaaagttttaa |
170 |
Q |
| |
|
|||| ||||||||||||||||| ||||||| || ||| || |||||||||||| | | ||||||||||| ||||||| ||| || ||||| |||||| | |
|
|
| T |
51546918 |
gattagagagctttgtggtttcagatattgatacttggagggaatgaagaaggatgttaatgatgtttggatttatgtctattgagatggagagttttga |
51546819 |
T |
|
| Q |
171 |
tgagttgaa |
179 |
Q |
| |
|
||| ||||| |
|
|
| T |
51546818 |
tgaattgaa |
51546810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University