View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4621-Insertion-6 (Length: 166)
Name: NF4621-Insertion-6
Description: NF4621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4621-Insertion-6 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
| [»] scaffold0312 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 3e-59; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 8 - 166
Target Start/End: Original strand, 440468 - 440641
Alignment:
| Q |
8 |
gcagagatgtagtgattgtaggaaattttgaccgcgaaaattagactgctatagaaaactatttgacaaaactttatactaaatggcatacagta----- |
102 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
440468 |
gcagagatgcagtgattgtaggaaattttgaccgcgaaaattagactgctatagaaaactatttgacaaaactttatactaaatggcatacagtagaata |
440567 |
T |
 |
| Q |
103 |
----------gactgcacaaaatccggattcattcataagcaataccttacgaaaaggaattaatgctgtcagc |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
440568 |
atagtaatttgactgcacaaaatccggattcattcataagcaataccttacgaaaaggaattaaagctgtcagc |
440641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 402955 - 403014
Alignment:
| Q |
103 |
gactgcacaaaatccggattcattcataagcaataccttacgaaaaggaattaatgctgt |
162 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||| | ||| |||||||||||||| |
|
|
| T |
402955 |
gactgcacaaaatcaagaatcattcataagcaatacctttctaaagggaattaatgctgt |
403014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 166
Target Start/End: Original strand, 410027 - 410086
Alignment:
| Q |
107 |
gcacaaaatccggattcattcataagcaataccttacgaaaaggaattaatgctgtcagc |
166 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||| | ||| || ||||||||||||||| |
|
|
| T |
410027 |
gcacaaaatccagattcattcataaccaatacctttctaaagggtattaatgctgtcagc |
410086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0312 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0312
Description:
Target: scaffold0312; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 166
Target Start/End: Complemental strand, 20543 - 20484
Alignment:
| Q |
107 |
gcacaaaatccggattcattcataagcaataccttacgaaaaggaattaatgctgtcagc |
166 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||| | ||| || ||||||||||||||| |
|
|
| T |
20543 |
gcacaaaatccagattcattcataaccaatacctttctaaagggtattaatgctgtcagc |
20484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University