View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4621-Insertion-7 (Length: 147)
Name: NF4621-Insertion-7
Description: NF4621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4621-Insertion-7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 9e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 9e-25
Query Start/End: Original strand, 8 - 147
Target Start/End: Original strand, 40516813 - 40516952
Alignment:
| Q |
8 |
caaaacttggctaaaaaatcatatggtgaggtgtcatcaagtgtttattaggtattaacaatnnnnnnnnnnnnnnnnnnnnnntcaggttggagcagtt |
107 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
40516813 |
caaaacttagctaaaaaatcatatggtgaggtgtcatcaagtgcttattaggtattaacaataaaaaattaaaatattaaaaaatcaggttggagcagtt |
40516912 |
T |
 |
| Q |
108 |
gggcctagttaagcacccaaatagagtgttctattgtgga |
147 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
40516913 |
gggcctagttaagcacccaaatggagtgctctattgtgga |
40516952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University