View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4622_low_11 (Length: 227)
Name: NF4622_low_11
Description: NF4622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4622_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 75 - 205
Target Start/End: Complemental strand, 3783372 - 3783243
Alignment:
| Q |
75 |
acctttgtctagcggttatgaggtttttggcttgttgctgcttgttcaaattttttatatgtgcttgaattagtttaaatggaattaaaatttgttcaga |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3783372 |
acctttgtctagcggttatgaggtttttggcttgttgctgcttgttcaaattttt-atatgtgcctgaattagtttaaatggaattaaaatttgttcaga |
3783274 |
T |
|
| Q |
175 |
gttacgcctcttgttataatttgttatctac |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3783273 |
gttacgcctcttgttataatttgttatctac |
3783243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 3783419 - 3783364
Alignment:
| Q |
1 |
tcatcacaaaaccaaatacccattactgtcattgaaccaccaccgaaaactttgtc |
56 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| |||||||||| || ||||||| |
|
|
| T |
3783419 |
tcatcacaaaaccacatacccagtactgtcattgtaccaccaccgcaacctttgtc |
3783364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University