View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4622_low_4 (Length: 346)
Name: NF4622_low_4
Description: NF4622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4622_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 25 - 343
Target Start/End: Original strand, 51525372 - 51525690
Alignment:
| Q |
25 |
ggtaatacaggagcacaatataaagcatacacacgaatagttgaagcagacgcatgaatattgagatttcattattgacagtannnnnnnagtttgtggg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51525372 |
ggtaatacaggagcacaatataaagcatacacacgaatagttgaaggagacgcatgaatattgagatttcattattgacagtatttttttagtttgtggg |
51525471 |
T |
 |
| Q |
125 |
tggttgctttcattccaatcaatcaaagacgaaaataattccctcgaattgcacgagtcaatgacaaataccacatcctttattttccgctactacttgt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51525472 |
tggttgctttcattccaatcaatcaaagacgaaaataattccctcgtattgcacgagtcaatgacaaataccacatcctttattttccgctactacttgt |
51525571 |
T |
 |
| Q |
225 |
accaccacttgcctgtaaacatgatcatttttatatcccctccccactaactagttttaatcacctcatccaaatttcaaatccaataacactgacattg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51525572 |
accaccacttgcctgtaaacatgatcatttttatatcccctccccactaactagttttaatcacctcatccaaatttcaaatccaataacactgacattg |
51525671 |
T |
 |
| Q |
325 |
acatgagtattatctaccc |
343 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
51525672 |
acatgagtattatttaccc |
51525690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University