View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4623-Insertion-9 (Length: 110)
Name: NF4623-Insertion-9
Description: NF4623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4623-Insertion-9 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 1e-44; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 8 - 110
Target Start/End: Original strand, 786074 - 786175
Alignment:
| Q |
8 |
tgtgtatgcatttgggcaaagatttagccactttcggcaaaacaaagtataaagaggaagtgtgcaagcatggctaaagaaaactgatgattttactgaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
786074 |
tgtgtatgcatttgggcaaagatttagccactttcggcaaaacaaagtat-aggaggaagtgtgcaagcatggctaaagaaaactgatgattttactgaa |
786172 |
T |
|
| Q |
108 |
aga |
110 |
Q |
| |
|
||| |
|
|
| T |
786173 |
aga |
786175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University