View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4623_low_6 (Length: 239)
Name: NF4623_low_6
Description: NF4623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4623_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 52675613 - 52675786
Alignment:
| Q |
1 |
agatctgatgatacttctttttcttctgtgtgttgattcaaggtagtaaatattctagcttgaggaactctttgtttgattgacagaaattcttccaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52675613 |
agatctgatgatacttctttttcttctgtgtgttgattcaaggtagtaaatattctagcttgaggaactctttgtttgattgacagaaattcttccaaca |
52675712 |
T |
 |
| Q |
101 |
tctccagacccatgttgcctgcaaattgctgctacttttgtgtatgagaatattttcccgcgaggtactgtata |
174 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52675713 |
tttccagacccatgttgcctgcaaattgctgctacttttgtgtatgagaatattttcccgcgaggtactgtata |
52675786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 191 - 232
Target Start/End: Original strand, 52675820 - 52675861
Alignment:
| Q |
191 |
attaattaatttgagagggtagggtagtgatgaatgatgatg |
232 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52675820 |
attagttaatttgagagggtagggtagtgatgaatgatgatg |
52675861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University