View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4624-Insertion-5 (Length: 114)
Name: NF4624-Insertion-5
Description: NF4624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4624-Insertion-5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 1e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 2783210 - 2783140
Alignment:
| Q |
8 |
actctttcaagagttctttgatggacattcctcttgtttcagtcttaagatcattcatcatcatttgtata |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2783210 |
actctttcaagagttctttgatggacattcctcttgtttcagtcttaagatcattcatcatcatttgtata |
2783140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University