View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4624-Insertion-6 (Length: 85)
Name: NF4624-Insertion-6
Description: NF4624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4624-Insertion-6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 3e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 3e-35
Query Start/End: Original strand, 7 - 81
Target Start/End: Original strand, 23779269 - 23779343
Alignment:
| Q |
7 |
aggagctagcttaaatgcttccatatctggtgtagtacctcttccacattcaccagcactttcaacactatgaat |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23779269 |
aggagctagcttaaatgcttccatatctggtgtagtacctcttccacattcaccagcactttcaacactatgaat |
23779343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 7e-18
Query Start/End: Original strand, 14 - 79
Target Start/End: Original strand, 23755543 - 23755608
Alignment:
| Q |
14 |
agcttaaatgcttccatatctggtgtagtacctcttccacattcaccagcactttcaacactatga |
79 |
Q |
| |
|
|||||||| ||||| |||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
23755543 |
agcttaaaagcttcattatctggtgtagtaccccttccacattcaccagcactttcaactctatga |
23755608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University