View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4624_high_10 (Length: 303)
Name: NF4624_high_10
Description: NF4624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4624_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 8934209 - 8933922
Alignment:
| Q |
1 |
cttaaggctttcatgccctaaccaacacatacttatcgatccagtctttcttgatcctaataatgcagtagctagcttaaattgaagtagcaaaacttgg |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8934209 |
cttaaggcttttatgccctaaccaacacatacttatcgatccagtatttcttgatcctaataatgcagtagctagcttaaattgaagtagcaaaacttgg |
8934110 |
T |
|
| Q |
101 |
gtgacaaaaatcgtatgnnnnnnnctttctttaataaaagcaaatgagttaggttcttgtggaaatagaggaatcatgtcgtatgtgtctatttaactag |
200 |
Q |
| |
|
|||| |||||| ||||| ||| ||||||||||||||||||||||||||||||||| |||||||||| || ||||||||||| || || | || |
|
|
| T |
8934109 |
gtgagaaaaatggtatgtttttttcttcctttaataaaagcaaatgagttaggttcttgtgtaaatagaggagtcgtgtcgtatgtgactcatt--caag |
8934012 |
T |
|
| Q |
201 |
tattgattttattttaggcattta-tactagatgaatacatatttgtcattttgttatgattcttttaacgtgaaatcgtggtccctctc |
289 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||||||||||||||||||||| |||| |||||| |||||||| ||||||||||| |
|
|
| T |
8934011 |
tattgattttatttttggcatttacttgatgatgaatacatatttgtcattttgtattgatatttttaatgtgaaatcttggtccctctc |
8933922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University