View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4624_high_5 (Length: 332)
Name: NF4624_high_5
Description: NF4624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4624_high_5 |
 | |
|
| [»] scaffold0140 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 16 - 320
Target Start/End: Original strand, 36933 - 37239
Alignment:
| Q |
16 |
tcctccccatcagttccttttgcttggttgttcttgtgaatattctcattccaattcactaggcctgtcaccaactcccttgtaaccttctctagttcct |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
36933 |
tccttcccatcagttccttttgcttggttgttcttctgaatattctcattccaattcactagacctgtgaccaactcccttgtaaccttttctagttcct |
37032 |
T |
|
| Q |
116 |
ctggtggaagcatcttcaggtctctcaacattgcttcagcttgagtctctgatggacccccaacagtcatgaccttcttgccttg-aacttttgcaata- |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37033 |
ctggtggaagcatcttcaggtctctcaacattgcttcagcttgactctctgatggacccccaacagtcatgaccttcttgccttgtaacttttgcaatat |
37132 |
T |
|
| Q |
214 |
ttcttttgacatttcaacaaaccagtaataacatgagttgtgtcatcaataaagtcat-gtggcaatggctggttctgagttgcttcctttggaccactt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| || | || |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37133 |
ttcttttgacatttcaacaaaccagtaataacatcagttgtgtcatcaa-aatttgatggtggcaatggctggttctgagttgcttcctttagaccactt |
37231 |
T |
|
| Q |
313 |
atgttctg |
320 |
Q |
| |
|
|||||||| |
|
|
| T |
37232 |
atgttctg |
37239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 285 - 315
Target Start/End: Original strand, 37234 - 37264
Alignment:
| Q |
285 |
gttctgagttgcttcctttggaccacttatg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37234 |
gttctgagttgcttcctttggaccacttatg |
37264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University