View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4625-Insertion-3 (Length: 222)
Name: NF4625-Insertion-3
Description: NF4625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4625-Insertion-3 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 45 - 222
Target Start/End: Original strand, 11369323 - 11369500
Alignment:
| Q |
45 |
tttgcaggagttgtttacattgatttgaagaatgatgcaccccaacaaactttgaagaagctgattgatgttatttgttctaacatgacacagaagaagg |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11369323 |
tttgcaggagttgtttacattgatttgaagaatgatgcaccccaacaaactttgaagaagctgattgatgttatttgttctaacatgacacagaagaagg |
11369422 |
T |
 |
| Q |
145 |
gagacaattatcttcttgtagagaaaaagacaatcaaggagatagttagttgaccgctgattttcttttacatcgata |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11369423 |
gagacaattatcttcttgtagagaaaaagacaatcaaggagatagtaagttgaccgctgattttcttttacatcgata |
11369500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University