View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4625_high_3 (Length: 251)
Name: NF4625_high_3
Description: NF4625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4625_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 45280160 - 45279893
Alignment:
| Q |
1 |
ccttggaagtatataaaatgatcattatgaaaaataaaccaaaatgatcagtatgaacttttactcttactgtta----attaacctttgtttt------ |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45280160 |
ccttggaagtatataaaatgatcattatgaaaaataaaccaaaatgatcagtatgaacttttactcttactgttaattaattaacctttgttttatgtta |
45280061 |
T |
|
| Q |
91 |
--------------gttgcaaacataaatttatgtacaagaatacttatatatctattttcaatttcagtctctctcaaatagtgttgaagacaaggcga |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45280060 |
atgcgaattgttttgttgcaaacataaatttatgtacaagaatacttatatatctattttcaatttcagtctctctcaaatagtgttgaagacaaggcga |
45279961 |
T |
|
| Q |
177 |
aacttttcatcaacaagctcaaaggtacttgctatttttataacatatttgcagtttgagaataatct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45279960 |
aacttttcatcaacaagctcaaaggtacttgctatttttataacatatttgcagtttgagaataatct |
45279893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University