View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4625_low_1 (Length: 354)
Name: NF4625_low_1
Description: NF4625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4625_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 3685976 - 3685774
Alignment:
| Q |
1 |
actgttttctaccctggttagcatcaggccttaaaattttgattgcaacatttgtatgatcaagttgacctttaaacacaggtccatatccaccttcacc |
100 |
Q |
| |
|
|||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685976 |
actgttttctaccctgattggcatcaggtcttaaaattttgattgcaacatttgtatgatcaagttgacctttaaacacaggtccatatccaccttcacc |
3685877 |
T |
 |
| Q |
101 |
tattttcattgataatgagaaattttgagtagccttttcaatttcgtctaaggtgtattgtctatatcgaatatctttacgagccaacacatttagtgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685876 |
tattttcattgataatgagaaattttgagtagccttttcaatttcgtctaaggtgtattgtctatatcgaatatctttacgagccaacacatttagtgct |
3685777 |
T |
 |
| Q |
201 |
tga |
203 |
Q |
| |
|
||| |
|
|
| T |
3685776 |
tga |
3685774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 279 - 347
Target Start/End: Complemental strand, 3685698 - 3685630
Alignment:
| Q |
279 |
atagcttcatcagctgctttgattgcagcttttgctttagctttctccttttctgctaatgcctatgct |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3685698 |
atagcttcatcagctgctttgattgcagcttttgctttagctttctccttttctgctaatgccaatgct |
3685630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 57 - 113
Target Start/End: Original strand, 48236554 - 48236610
Alignment:
| Q |
57 |
tgatcaagttgacctttaaacacaggtccatatccaccttcacctattttcattgat |
113 |
Q |
| |
|
|||| ||| |||||||||||||||||||| |||||||||||||||| |||| ||||| |
|
|
| T |
48236554 |
tgatgaaggtgacctttaaacacaggtccgtatccaccttcacctagtttctttgat |
48236610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University