View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4626-Insertion-6 (Length: 120)
Name: NF4626-Insertion-6
Description: NF4626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4626-Insertion-6 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 64; Significance: 2e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 2e-28
Query Start/End: Original strand, 53 - 120
Target Start/End: Original strand, 36985430 - 36985497
Alignment:
| Q |
53 |
gggcttcatactttgagtgaatgtggatgaagccttacctgcttggtttcatgaatttcttttttctc |
120 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36985430 |
gggcttcatattttgagtgaatgtggatgaagccttacctgcttggtttcatgaatttcttttttctc |
36985497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 64 - 120
Target Start/End: Original strand, 36996919 - 36996975
Alignment:
| Q |
64 |
tttgagtgaatgtggatgaagccttacctgcttggtttcatgaatttcttttttctc |
120 |
Q |
| |
|
|||||||||||||| |||||||||||| || |||||| || |||||||||||||||| |
|
|
| T |
36996919 |
tttgagtgaatgtgaatgaagccttacttgtttggttgcaggaatttcttttttctc |
36996975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University