View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4626_high_1 (Length: 415)
Name: NF4626_high_1
Description: NF4626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4626_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 3e-98; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 87 - 337
Target Start/End: Complemental strand, 47341728 - 47341477
Alignment:
| Q |
87 |
taacagctaactcgagtcccgagtcataaaatcannnnnnnttttgccacatttaatcgccccttcctttattgagtgttaccctgttaaatggtttcgc |
186 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47341728 |
taacagttaactcgagtcccgagtcataaaattagggggggttttgccacatttaaccgccccttcctttattgagtgtcaccctgttaaatggtttcgc |
47341629 |
T |
 |
| Q |
187 |
tttacggtaaatttcagaggaaaaaacatattgggagtcaaaacttcnnnnnnntgatgtcaaaatcgta-aatgacaaagacttgaaaggtcagagagt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
47341628 |
tttacggtaaatttcagaggaaaaaacatattgggagtcaaaacttcaaaaaaatgatgtcaaaatcgtacaatgacaaagacttgaaaggtcaaagagt |
47341529 |
T |
 |
| Q |
286 |
acatttgatcctacttttttatggtgataaatactccaattctagtctttac |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47341528 |
acatttgatcctacttttttatggtgataaatactccaattctagtctttac |
47341477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 47349618 - 47349557
Alignment:
| Q |
18 |
ctaaatagtgtttcccaccagtttgaagagacacgtggcacagattcagagcatttgggatg |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
47349618 |
ctaaatagtgtttcccaccagtttgaagagacacgtggcagagattcggagcatttgggatg |
47349557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 47347079 - 47347019
Alignment:
| Q |
18 |
ctaaatagtgtttcccaccagtttgaagagacacgtggcacagattcagagcatttgggat |
78 |
Q |
| |
|
||||||||||||| ||||| |||||||| |||||||||| |||||| | || |||||||| |
|
|
| T |
47347079 |
ctaaatagtgttttccaccggtttgaagtgacacgtggcggagattcggtgcgtttgggat |
47347019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University