View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4627-Insertion-16 (Length: 153)
Name: NF4627-Insertion-16
Description: NF4627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4627-Insertion-16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 13 - 153
Target Start/End: Complemental strand, 19466570 - 19466430
Alignment:
| Q |
13 |
atactcgaattttgcttgtctttttctcaatatacatctctccttacaagtttagtctgcaaaatataataagcaataggaacataattaaattggatca |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19466570 |
atactccaattttgcttgtctttttctcaatatacatctatccttacaagtttagtctgcaaaatataataagcaataggaacataattaaattggatca |
19466471 |
T |
|
| Q |
113 |
caattgacagttccattaaagattgaactgaaccaaccaga |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19466470 |
caattgacagttccattaaagattgaactgaaccaaccaga |
19466430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University