View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4627-Insertion-17 (Length: 125)
Name: NF4627-Insertion-17
Description: NF4627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4627-Insertion-17 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 6e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 2625394 - 2625277
Alignment:
| Q |
8 |
ctgttaggttcttaggagcaataggtggccttgtaccaatcccgatccattatatttatttggaaaataaacgatagacgataaaaaatctcggaaatca |
107 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
2625394 |
ctgttaggttcttaggagcaataggtgaccttgtaccaatcccgatccattatatttatttggaaaataaacgatagacaataaaacatctcggaaatca |
2625295 |
T |
|
| Q |
108 |
agaggttggttttgtgga |
125 |
Q |
| |
|
| ||| |||||||||| |
|
|
| T |
2625294 |
gggggtcagttttgtgga |
2625277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 8 - 106
Target Start/End: Original strand, 27244837 - 27244935
Alignment:
| Q |
8 |
ctgttaggttcttaggagcaataggtggccttgtaccaatcccgatccattatatttatttggaaaataaacgatagacgataaaaaatctcggaaatc |
106 |
Q |
| |
|
||||||| |||||| ||||||||||| |||| ||||||||||||||||||| |||| || |||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
27244837 |
ctgttagattcttaatagcaataggtgaccttataccaatcccgatccattagatttgttcggaaaaacaacgatagacaataaaacatctcggaaatc |
27244935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University