View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4627-Insertion-20 (Length: 63)
Name: NF4627-Insertion-20
Description: NF4627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4627-Insertion-20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 8e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 8 - 61
Target Start/End: Complemental strand, 21157148 - 21157095
Alignment:
| Q |
8 |
ccagtatcctaccattgtttaactggtactcatcttctctctcattgatgcgct |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21157148 |
ccagtatcctaccattgtttaactggtactcatcttctctctcattgatgcgct |
21157095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 1e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-21
Query Start/End: Original strand, 8 - 63
Target Start/End: Complemental strand, 4117843 - 4117788
Alignment:
| Q |
8 |
ccagtatcctaccattgtttaactggtactcatcttctctctcattgatgcgctct |
63 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4117843 |
ccagtatcctaccattgtttaactgttactcatcttctctctcattgatgcgctct |
4117788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University