View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4627_high_18 (Length: 315)
Name: NF4627_high_18
Description: NF4627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4627_high_18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 19 - 315
Target Start/End: Original strand, 47839862 - 47840160
Alignment:
| Q |
19 |
atatcagatttcctcgtttgtgttgtgttgtaaatgacaaatctatttccatggcagataaatgatcatggcaggttggtggttgtgtattttcttggag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47839862 |
atatcagatttcctcgtttgtgttgtgttgtaaatgacaaatctatttccatggcagataaatggtcatggcaggttggtagttgtgtattttcttggag |
47839961 |
T |
 |
| Q |
119 |
cttgaacaacattttgaataacgtttgacagtgtggaaactgctgtttt--gagaagtctggtacggaaggttcgtccgtgggtcgaagaggcagattct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47839962 |
cttgaacaacattttgaataacgtttgacagtgtggaaactgctgttttttgagaagtctggtacggaaggttcgtccgtgggtcgaagaggcagattct |
47840061 |
T |
 |
| Q |
217 |
tttgtttggctacctgaatcgatgaagtgttttactgtgaaaagctgctagatgctgttgtctaatttccggacagttgaggacacggacggtgacttt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47840062 |
tttgtttggctacctgaatcgatgaagtgttttactgtgaaaagctgctagatgctgttgtctaatttccggacagttgaggacatggacggtgacttt |
47840160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University