View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4627_high_25 (Length: 252)
Name: NF4627_high_25
Description: NF4627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4627_high_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 34745750 - 34745528
Alignment:
| Q |
7 |
tgaaatagctcatcttttgagttgaaaacaaa-taataaagaatcttatgatgaattattgcaatattttcatgctaaaatgatactcattttcgaattc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
34745750 |
tgaaatagctcatcttttgagttgaaaacaaaataataaagaatcttatgatgaattattgcaatattttcatgctaaaatggtactcattttggaattc |
34745651 |
T |
|
| Q |
106 |
ttttaatgtttcgtgttt-aaaatcacgacgagttagacaaaatcacaatagcatcatgattttgttgaaattttgannnnnnnnnnngccaaacttacc |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
34745650 |
ttttaatgtttcgtgtttcaaaatcacgacgagttagacaaaatcacaatagcatcatgattttgttgaaattccga--tttttttttgccaaacttacc |
34745553 |
T |
|
| Q |
205 |
ataatttcaaacatgccataatgtt |
229 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34745552 |
ataatttcaaacatgccataatgtt |
34745528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 144 - 177
Target Start/End: Complemental strand, 34734813 - 34734780
Alignment:
| Q |
144 |
aaaatcacaatagcatcatgattttgttgaaatt |
177 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
34734813 |
aaaatcacaataacatcatgattttgttgaaatt |
34734780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 51 - 84
Target Start/End: Complemental strand, 34734906 - 34734873
Alignment:
| Q |
51 |
ttatgatgaattattgcaatattttcatgctaaa |
84 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
34734906 |
ttatgatgaattattgcaacattttcatgctaaa |
34734873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University