View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4627_high_26 (Length: 249)
Name: NF4627_high_26
Description: NF4627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4627_high_26 |
 | |
|
| [»] scaffold0016 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 62 - 219
Target Start/End: Original strand, 33692047 - 33692204
Alignment:
| Q |
62 |
tctccccacaattgatatcagataaccaaaattgtataataaacatgaataaatgataatttttaaacggtgaaacatatattaataatcaatgaccgat |
161 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33692047 |
tctccccaaaattgatatcagataaccaaaattgtataataaacatgaataaatgttaatttttaaacggtgaaacatatattaataatcaatgaccgat |
33692146 |
T |
|
| Q |
162 |
gaaaattaaacttttttactatcacacaagaaatggaaaaacatacataatatatata |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33692147 |
gaaaattaaacttttttactatcacacaagaaatggaaaaacattcataatatatata |
33692204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 89718 - 89670
Alignment:
| Q |
175 |
ttttactatca-cacaagaaa-tggaaaaacatacataatatatataca |
221 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
89718 |
ttttactatcaacacaagaaaatggaaaaacatacataagatatataca |
89670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University