View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4627_high_27 (Length: 249)
Name: NF4627_high_27
Description: NF4627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4627_high_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 24253835 - 24253678
Alignment:
| Q |
1 |
tcaatataggactttgatgggaatacagtatgccgattgccatttcaactcgaccgttagcatatcgaattgttttgttatatgggatcattttcagatt |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24253835 |
tcaatataggactttgatgggaataaagtatgctgattgccatttcaactcgaccgttagcatatcgaattgttttgttatatgggatcattttcagatt |
24253736 |
T |
|
| Q |
101 |
tcctaactcgcttaccttctttagactcataaggttcgcatttgctctggaatcacat |
158 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24253735 |
tcctaactcgcttgccttctttagactcataaggttcgcatttgctccggaatcacat |
24253678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 154 - 240
Target Start/End: Complemental strand, 24253645 - 24253559
Alignment:
| Q |
154 |
cacatggagtgtataccatccttcaccatcaaacttgacggttgcaggtacctcgaagttgatgcgacactcttcagtaagtattat |
240 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24253645 |
cacagggagtgtatagcatccttcaccatcaaacctgacggttgcaggtacctcgaagttgatgcgacactcttcagtaagtgttat |
24253559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 154 - 235
Target Start/End: Complemental strand, 22567506 - 22567425
Alignment:
| Q |
154 |
cacatggagtgtataccatccttcaccatcaaacttgacggttgcaggtacctcgaagttgatgcgacactcttcagtaagt |
235 |
Q |
| |
|
|||| ||||| |||| ||||||||||||| ||||||||||||| | | ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
22567506 |
cacaaggagtatataacatccttcaccattgaacttgacggttgtaagaacctcgaagttaatgtgacactcttcagtaagt |
22567425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 90 - 157
Target Start/End: Complemental strand, 22567607 - 22567540
Alignment:
| Q |
90 |
attttcagatttcctaactcgcttaccttctttagactcataaggttcgcatttgctctggaatcaca |
157 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||||||| |||||| |||| |||| ||||||||| |
|
|
| T |
22567607 |
attttcagattccctaactcgcttgccttcttaagactcattaggttcacattggctccggaatcaca |
22567540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 154 - 233
Target Start/End: Original strand, 11389862 - 11389941
Alignment:
| Q |
154 |
cacatggagtgtataccatccttcaccatcaaacttgacggttgcaggtacctcgaagttgatgcgacactcttcagtaa |
233 |
Q |
| |
|
|||| |||||||||| ||||||||||| ||||||||| ||| || |||||||||||||||||| || ||||||||||| |
|
|
| T |
11389862 |
cacagggagtgtataacatccttcaccgtcaaacttggcggacacatgtacctcgaagttgatgcaaccctcttcagtaa |
11389941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 154 - 233
Target Start/End: Original strand, 11406523 - 11406602
Alignment:
| Q |
154 |
cacatggagtgtataccatccttcaccatcaaacttgacggttgcaggtacctcgaagttgatgcgacactcttcagtaa |
233 |
Q |
| |
|
|||| |||||||||| ||||||||||| ||||||||| ||| || |||||||||||||||||| || ||||||||||| |
|
|
| T |
11406523 |
cacagggagtgtataacatccttcaccgtcaaacttggcggacacatgtacctcgaagttgatgcaaccctcttcagtaa |
11406602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University