View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4627_low_22 (Length: 282)
Name: NF4627_low_22
Description: NF4627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4627_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 8e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 49825952 - 49826043
Alignment:
| Q |
1 |
atgattttagtgagctgtcggtgttggaaggaaggaagaaaagcatagtgaacctcaagcggatatttcctagtattgcaatgacaaatatt |
92 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49825952 |
atgattttagtgagcggacggtgttggaaggaaggaagaaaagcacggtgaacctcaagcagatatttcctagtattgcaatgacaaatatt |
49826043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 131 - 189
Target Start/End: Original strand, 49826075 - 49826133
Alignment:
| Q |
131 |
ttgaagcaacatgcattaatcaaagcaatttcaacaaaaatttaaggttgaagttgtcg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49826075 |
ttgaagcaacatgcattaatcaaagcaatttcaacaaaaatttaaggttgaagttgtcg |
49826133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University