View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4627_low_24 (Length: 270)
Name: NF4627_low_24
Description: NF4627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4627_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 36477065 - 36477283
Alignment:
| Q |
1 |
tccaaatccctttgtaccctatatgttgcttcaagataaaactatgcatgtggggattttcaaaaccttcacatcaaatattaaataactgctcggtaaa |
100 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36477065 |
tccaagtccctttgtaccctatattttgcttcaagataaaactatgcatgtggggattttcaaaaccttcacatcaaatattaaataactgctcggtaaa |
36477164 |
T |
 |
| Q |
101 |
tgttgagtaagaaaaagaaatttgaggcgaacatacatgatggattatttgtaagtgcttttgttagcgtttttgagtattgacaattgccctgactctg |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36477165 |
tattgagtaagaaaaagaaatttgaggcgaacatacatgatagattatttgtaagtgcttttgttagcgtttttgagtattgacaattgccctgactctg |
36477264 |
T |
 |
| Q |
201 |
gtaagtcccactcacttca |
219 |
Q |
| |
|
|| || ||||||||||||| |
|
|
| T |
36477265 |
gtgagccccactcacttca |
36477283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 44 - 115
Target Start/End: Original strand, 36467407 - 36467480
Alignment:
| Q |
44 |
atgcatgtggggattttcaaaaccttcacatcaaatattaaataactgctcggtaaatg--ttgagtaagaaaa |
115 |
Q |
| |
|
|||||||| | |||||||||||| || ||||||||| ||| ||||| |||||||||||| ||||||||||||| |
|
|
| T |
36467407 |
atgcatgtagagattttcaaaactttgacatcaaatgttatataaccgctcggtaaatgttttgagtaagaaaa |
36467480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University