View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4627_low_25 (Length: 257)
Name: NF4627_low_25
Description: NF4627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4627_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 48091798 - 48091602
Alignment:
| Q |
17 |
cattgagttcaggacttaaataaggcaacgttggttctgccccaagtgcttgacctgcaaaatcattgcatnnnnnnnnnn------ctatataagttta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48091798 |
cattgagttcaggacttaaataaggcaacgttggttctgccccaagtgcttgacctgcaaaatcattgcataaaaaaaaaaaaaaaactatataagttta |
48091699 |
T |
|
| Q |
111 |
atgttaatcacattattatgggggatataaattttgcatggttgctgagtgagggagaattaggtcgaagattcaatcttcactctcaacatagaaat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48091698 |
atgttaatcacattattatgggggatataaattttgcatggttgctgagtgagggagaattaggtcgaagattcaatcttcactctcaa-atagaaat |
48091602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 226 - 257
Target Start/End: Complemental strand, 48091611 - 48091580
Alignment:
| Q |
226 |
aaatagaaatgaatgattatcttaactgatga |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48091611 |
aaatagaaatgaatgattatcttaactgatga |
48091580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University