View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4627_low_27 (Length: 252)

Name: NF4627_low_27
Description: NF4627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4627_low_27
NF4627_low_27
[»] chr4 (1 HSPs)
chr4 (1-239)||(30715281-30715519)


Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 30715519 - 30715281
Alignment:
1 caatgtgtgcttcttgtgagaaagatggtttaccatgtggtgcattggacaaggattcagaaacatcatcgtcatcgtcatcattgtcttcttcctcttt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
30715519 caatgtgtgcttcttgtgagaaagatggtttaccatgtggtgcattggacaaggattcagaaacatcatcgtcatcgtcatcattgtcttcttcctcttc 30715420  T
101 ttcggtttcatcttcaaattgtcggtgttgatcctcttgagatttagaatccacatcgtttgcatcagtactattattatcgttgtcctcgtctttgtat 200  Q
    |||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
30715419 ttcggtttcatcttcaaactgtcggtgttgatcctcttgagattcagaatccacatcgtctgcatcagtactattattatcgttgtcctcgtctttgtat 30715320  T
201 tcttctgataacttttgttttggaattctatgatgatgt 239  Q
    ||||||||||||||||||||||||||||||| |||||||    
30715319 tcttctgataacttttgttttggaattctattatgatgt 30715281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University