View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4627_low_31 (Length: 249)
Name: NF4627_low_31
Description: NF4627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4627_low_31 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 5 - 249
Target Start/End: Original strand, 51388905 - 51389149
Alignment:
| Q |
5 |
gctagattattctttcatcccacaacattggcattcagcttcttctaactcttcaatgtcatcaaattttctttctacttccaagctatagtatttgtta |
104 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51388905 |
gctacattcttctttcatcccacaacattggcattcagcttcttctaactcttcaatgtcatcaaattttctttctacttccaagctatagtatttgtta |
51389004 |
T |
|
| Q |
105 |
atttcttgagacacgtccgagaccgcctttcgtagcctttgctgactctcctcctatatatggaaacaggaaattagtattgtcaagtatgacaaactat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51389005 |
atttcttgagacacgtccgagaccgcctttcgtagcctttgctgactctcctcctatatatggaaacaggaaattagtattgtcaagtatgccaaactat |
51389104 |
T |
|
| Q |
205 |
attgaaaattaaatcagcgacaaaatgaataaattagagaataat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51389105 |
attgaaaattaaatcagcgacaaaatgaataaattagagaataat |
51389149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University