View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4628-Insertion-15 (Length: 247)
Name: NF4628-Insertion-15
Description: NF4628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4628-Insertion-15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 103 - 180
Target Start/End: Complemental strand, 32241428 - 32241351
Alignment:
| Q |
103 |
ttaagggtattcatcaaagagcttgcaattcaatctatgatattggattaacatatatattaaggtacttgctcttcc |
180 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32241428 |
ttaagggtgttcatcaatgagcttgcaattcaatctatgatattggattaacatatatattaaggtacttgctcttcc |
32241351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 32241526 - 32241460
Alignment:
| Q |
8 |
tttataagcttcaaataaataagttatcatcaacaatatttctctctttgtgatttattttttctct |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32241526 |
tttataagcttcaaataaataagttatcatcaacaatatttctctctttgtgatttattttttctct |
32241460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University