View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4628-Insertion-20 (Length: 108)
Name: NF4628-Insertion-20
Description: NF4628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4628-Insertion-20 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 1e-50; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 1e-50
Query Start/End: Original strand, 4 - 108
Target Start/End: Complemental strand, 1216235 - 1216131
Alignment:
| Q |
4 |
aacaaaacattaggttttcttgttgaaccctccctccctcctcaaagtttggtttataaccaaaactgaatgcgttaaaactgaactgaatcgaaccatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1216235 |
aacaaaacattaggttttcttgttgaaccctccctccctcctcaaagtttggtttataaccaaaactgaatgcgttaaaactgaactgaaccgaaccatt |
1216136 |
T |
|
| Q |
104 |
tccaa |
108 |
Q |
| |
|
||||| |
|
|
| T |
1216135 |
tccaa |
1216131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University