View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4628_high_3 (Length: 239)
Name: NF4628_high_3
Description: NF4628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4628_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 19508856 - 19509087
Alignment:
| Q |
1 |
actgttgagtgaagttaagttattaatttttgcgatcctcgtggtcgaatattataataagaatgttgtttatgtgtccctcgtggtacataaaataatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19508856 |
actgttgagtgaagttaagttattaatttttgcgatcctcgtggtcgaatattataataagaatgttgcttatgtgtccctcgtggtacataaaataatt |
19508955 |
T |
 |
| Q |
101 |
tcatgattgctgacgttgtttgtcagctaacggtgtgtgatcgatacgtgttttttatgtttattgatggtaaa-----------ttgttttgttttgat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
19508956 |
tcatgattgctgacgttgtttgtcagctaacggtgtgtgattgatacgtgttttttatgtttatttatggtaaattgttaagattttgttttgtcttgat |
19509055 |
T |
 |
| Q |
190 |
gaataaatggttgagaatacttgtataatccc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19509056 |
gaataaatggttgagaatacttgtataatccc |
19509087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University