View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4628_low_5 (Length: 244)
Name: NF4628_low_5
Description: NF4628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4628_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 19091227 - 19091439
Alignment:
| Q |
18 |
gttatgagtatcatgtttggtttatgtagtcgaaccatttcatatgttttcatctcatatgtaactcatgatctgcagttgccttatatatcggaactta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19091227 |
gttatgagtatcatgtttggtttatgtagttgaaccatttcatatgtttttatctcatatgtaactcatgatctgcagttgccttatatatcggaactta |
19091326 |
T |
 |
| Q |
118 |
cttgctggcttcaagacatgcatggaaatagatagatacatgcgtgaagagatgccaaatggatctacagatgaaaatggaacatttgttgcacattata |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19091327 |
cttgctggcttcaagacatgcatggaaatagatagatacatgcgtgaagagatgccaaatggatctacagatgaaaatggaacatttgttgcacagtata |
19091426 |
T |
 |
| Q |
218 |
atgtgagtataat |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
19091427 |
atgtgagtataat |
19091439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University