View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4629_low_2 (Length: 288)
Name: NF4629_low_2
Description: NF4629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4629_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 51 - 127
Target Start/End: Original strand, 5017803 - 5017879
Alignment:
| Q |
51 |
taaattgaagaaagacatgaaactgtctctaaaggcagaaaattacaactctcaaattagagattgtcttaaatttg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5017803 |
taaattgaagaaagacatgaaactgtctctaaaggcagaaaattacaactttcaaattagagattgtcttaaatttg |
5017879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 216 - 273
Target Start/End: Original strand, 5017983 - 5018040
Alignment:
| Q |
216 |
gtgctttaaaaaagatgtaatatttgagacaatgcttacagctccttgggatccatct |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5017983 |
gtgctttaaaaaagatgtaatatttgagacaatgcttacagctccttgggatccatct |
5018040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 2 - 52
Target Start/End: Original strand, 5017724 - 5017774
Alignment:
| Q |
2 |
ttaaaactcatttttagtattattttcttcagcctagttaaatcaacttta |
52 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
5017724 |
ttaaaactcatttttagtattatttttttcaacctagttaaatcaacttta |
5017774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 121 - 154
Target Start/End: Original strand, 5017889 - 5017922
Alignment:
| Q |
121 |
aaatttggttgtccaatcatacttttgtttatga |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5017889 |
aaatttggttgtccaatcatacttttgtttatga |
5017922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University