View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4630_high_4 (Length: 230)
Name: NF4630_high_4
Description: NF4630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4630_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 28536071 - 28535980
Alignment:
| Q |
1 |
agaatgatattgtgaatttcaaattcttgtttattaattcaaaattaattnnnnnnnnnnnnctagcatgtgagaaaatatataagaccttgatgg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28536071 |
agaatgatattgtgaatttcaaattcttgtttattaattcaaaattaatt----aaaaaaaactagcatgtgagaaaatatataagaccttgatgg |
28535980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 28535911 - 28535865
Alignment:
| Q |
165 |
gagtaccttcctacctttatgtttggctcttcaactgctgctagttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28535911 |
gagtaccttcctacctttatgtttggttcttcaactgctgctagttg |
28535865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University