View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4630_low_3 (Length: 416)
Name: NF4630_low_3
Description: NF4630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4630_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 8e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 177 - 319
Target Start/End: Original strand, 10773929 - 10774070
Alignment:
| Q |
177 |
gccaaaagttcttctttatacaattttttgtatctcaccaccaaaaatttctatcttaacaaatttgtcaagttatcaaatgaaagatccttatgtaaaa |
276 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10773929 |
gccagaagttcttctttatacaattttttgtatctcaccaccaaaaatttctatcttaacaaatttgtcaagttatcaaatgaaagat-cttatgtaaaa |
10774027 |
T |
|
| Q |
277 |
tatttatatcgattaaaacaaaattgtagatgactttgtaatt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10774028 |
tatttatatcgattaaaacaaaattgtagatgactttgtaatt |
10774070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 10773721 - 10773854
Alignment:
| Q |
16 |
ttatgaaccaatgaaattaaagttttgtcgcggtgttggagtttgagcaaggcatcgatgaaccagtgtctattttatgaatgattttcgtatcttgtta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
10773721 |
ttatgaaccaatgaaattaaagttttgtcgcggcgttggagtttgagcaaggcatcgatgaaccattgtctattttatgaatgattttctgatcttgtta |
10773820 |
T |
|
| Q |
116 |
gatgtatggtgtgttgaacatgtaagaaagtaag |
149 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
10773821 |
gatgtatggtgtgctgaacatgtaagaaagtaag |
10773854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University