View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4631-Insertion-13 (Length: 478)
Name: NF4631-Insertion-13
Description: NF4631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4631-Insertion-13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 6e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 286 - 438
Target Start/End: Complemental strand, 7234197 - 7234044
Alignment:
| Q |
286 |
tgttgatatgcagcaaactttgaacaagaagtgtttattgcacaggaacaattgaatacgaagcatttaaacacaaaagtttaaacaagttaatgtttta |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7234197 |
tgttgatatgcagcaaactttgaacaagaagtgtttattgcacaggaacaattgaatacgaagcatttaaacacaaaagtttaaacaagttaatgtttta |
7234098 |
T |
 |
| Q |
386 |
gcagctcactagtttaaacaagagggtttaaataa-aaaatccgtattctgcct |
438 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
7234097 |
gtagctcactagtttaaacaagagggtttaaataaaaaaatccatattctgcct |
7234044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University