View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4631-Insertion-18 (Length: 321)
Name: NF4631-Insertion-18
Description: NF4631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4631-Insertion-18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 8 - 321
Target Start/End: Original strand, 46126601 - 46126915
Alignment:
| Q |
8 |
gggttccccctcctattggcactgtcnnnnnnn-ctgtgatggctcctctatagacagtccatctgctggctccattgggtttgttattagagatcataa |
106 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46126601 |
gggttccccctcctattggcactgtcaaaataaactgtgatggctcctctatagacagtccatctgctggctccattgggtttgttattagagatcataa |
46126700 |
T |
|
| Q |
107 |
tgccaaatttttgggagcttttacccaaaatgttgggcatgcttcggctttggaagctgagttttgcgcgtgtctgcgggctattgagaaagcgaaagag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46126701 |
tgccaaatttttgggagcttttacccaaaatgttgggcatgcttcggctttggaagctgagttttgcgcgtgtctgcgggctattgagaaagcgaaagag |
46126800 |
T |
|
| Q |
207 |
cttcactttcctgacatcattgtggaaaactgactctttaggagtggttaatgcctctaaaaattctgcaagtgtctcttggagaatgtcagctagatgg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46126801 |
cttcactttcctgacatcattgtggaaaactgactctttaggagtggttaatgcctctaaaaattctgcaagtgtctcttggagaatgtcagctagatgg |
46126900 |
T |
|
| Q |
307 |
tacaattgtaagcaa |
321 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46126901 |
tacaattgtaagcaa |
46126915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University