View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4631-Insertion-20 (Length: 241)
Name: NF4631-Insertion-20
Description: NF4631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4631-Insertion-20 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 7 - 241
Target Start/End: Complemental strand, 4207489 - 4207254
Alignment:
| Q |
7 |
aattatgtcttgggtacgtttataaaagaacgaattcaagtgatgtcatcnnnnnnncaagggaattctagtgatagttac--tttccaagctgtcaaca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4207489 |
aattatgtcttgggtacgtttataaaagaacgaattcaagtgatgtcatctttttttcaagggaattctagtgatagttacactttccaagctgtcaaca |
4207390 |
T |
|
| Q |
105 |
tactggtctatttcgaaagcaatattccaatatcttcaatgatgatttcattatactatttgtcacaactacttagctgttggccatccatatcttgccc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4207389 |
tactggtctatttcgaaagcaatattccaatatcttcaatgatgatttcattatactatttgtcacaactactt-gctgttggccatccatatcttgccc |
4207291 |
T |
|
| Q |
205 |
atttcacaaggaagtagcctcatatcaaattacttta |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4207290 |
atttcacaaggaagtagcctcatatcaaattacttta |
4207254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University