View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4631-Insertion-21 (Length: 189)
Name: NF4631-Insertion-21
Description: NF4631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4631-Insertion-21 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 11 - 189
Target Start/End: Complemental strand, 10500574 - 10500400
Alignment:
| Q |
11 |
caagatttaaattaataacataaatacattatgttatagcgagtcgacgtaattttgacaataactaaaatctaaaacttcaacaaaatcacagtgtcac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10500574 |
caagatttaaattaataacataaatacattatgttatagcgagtcgacgtaattttgacaataactaaaatctaaaacttcaacaaaattacagtgtcac |
10500475 |
T |
|
| Q |
111 |
tataattttgtaaatgtaccgcaatattccaaatatgcactaacttgaaaataggatgaatttgatttggctcaccgta |
189 |
Q |
| |
|
|| ||||||||||||||||||||| || |||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10500474 |
tacaattttgtaaatgtaccgcaa---tctaaatatgccctaacttgaaaata-gatgaatttgatttggctcaccgta |
10500400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 82 - 119
Target Start/End: Original strand, 24578527 - 24578564
Alignment:
| Q |
82 |
ctaaaacttcaacaaaatcacagtgtcactataatttt |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
24578527 |
ctaaaacttcaacaaaatcacagtatcactgtaatttt |
24578564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University