View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4631-Insertion-23 (Length: 107)
Name: NF4631-Insertion-23
Description: NF4631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4631-Insertion-23 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 8 - 107
Target Start/End: Original strand, 39852770 - 39852869
Alignment:
| Q |
8 |
aaagagatctcatccacatgacatgattgattttgaagtaggagagaaactaacctgatcaacagcaacaactgaaccaataccattgaaccagtaggat |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39852770 |
aaagtgatctcatccacatgacatgattgattttgaagtaggagagaaactaacctgatcaacagcaacaactgaaccaataccattgaaccagtaggat |
39852869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University