View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4631_high_11 (Length: 238)
Name: NF4631_high_11
Description: NF4631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4631_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 23766958 - 23767179
Alignment:
| Q |
1 |
ttgaaaccgtcgtttaatgaatcaatatctttctcttcctcgtacgatggaacattgatcttcaaattcaaaggaacatttttgtgttgtttttcttcat |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23766958 |
ttgaaaccgtcgtttaatggatcaatatctttctcttcctcgtacgatggaacattgatcttcaaattcaaaggaacatttttgtgttgtttttcttcat |
23767057 |
T |
|
| Q |
101 |
gttgttgcactagttgcttttttggcttaagctctttcattattgaaggttgatattcttgatcttgaacttccatataatnnnnnnnctaggttgaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23767058 |
gttgttgcactagttgcttttttggcttaagctctttcattattgaagattggtactcttgatcttgaacttccatataataaaaaaactaggttgaaga |
23767157 |
T |
|
| Q |
201 |
agatatattaataagaagtagt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
23767158 |
agatatattaataagaagtagt |
23767179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University