View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4631_high_14 (Length: 231)
Name: NF4631_high_14
Description: NF4631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4631_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 12 - 213
Target Start/End: Original strand, 40034466 - 40034677
Alignment:
| Q |
12 |
attatactatgtaatgttgcataggttagaaaaatccagtaaaattataggattatttttcattttaaaaatattcacattgtaaacttgcgaaataaca |
111 |
Q |
| |
|
||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40034466 |
attatcctatgcaatgttgcataggttaaaaaaatccagtaaaattataggattatttttcattttaaaaacattcacattgtaaacttgcgaaataaca |
40034565 |
T |
 |
| Q |
112 |
ttaatcaaattacggaatgtcataaaatcttaaagag----------taaaatagtcagtcacattatacaaagttgactattacataaatccaaatgta |
201 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40034566 |
taaatcaaattacggaatgtcataaaatcttaaagagtagtacaagctaaaatagtcagtcacattatacaaagttgactattacataaatccaaatgta |
40034665 |
T |
 |
| Q |
202 |
ggtcacacaatc |
213 |
Q |
| |
|
||||||| |||| |
|
|
| T |
40034666 |
ggtcacaaaatc |
40034677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 49
Target Start/End: Original strand, 43576072 - 43576108
Alignment:
| Q |
13 |
ttatactatgtaatgttgcataggttagaaaaatcca |
49 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
43576072 |
ttattctatataatgttgcataggttagaaaaatcca |
43576108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University