View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4631_high_4 (Length: 324)
Name: NF4631_high_4
Description: NF4631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4631_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 12 - 306
Target Start/End: Complemental strand, 27631273 - 27630979
Alignment:
| Q |
12 |
atcatcactgaaagcagtagtgtatctaacttcagctgaactagcacgagcaagatttgaaacatttggatcataatttgcgtttctaacgtaaccagat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27631273 |
atcatcactgaaagcagtagtgtatctaacttcagctgaactagcacgagcaagatttgaaacatttggatcataatttgcgtttctaacgtaaccagat |
27631174 |
T |
 |
| Q |
112 |
ggtgcttttttgtcataaacaccaggtgcataagggtgtgcaacaacatcgtatggaacataaggccatagctcaacccttttccctgtacgatgagaca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27631173 |
ggtgcttttttgtcataaacaccaggtgcataagggtgtgcaacaacatcgtatggaacataaggccatagctcaacccttttccctgtacgatgagaca |
27631074 |
T |
 |
| Q |
212 |
tgcgtgccaccaccttggaaggttccacgtagcctgtgactgttactttgcttgctttgcgatctacttccacttgtgtcactcctttcatccct |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27631073 |
tgcgtgccaccaccttggaaggttccacgtagcctgtgactgttactttgcttgctttgcgatctacttccacttgtgtcactcctttcatccct |
27630979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 191
Target Start/End: Original strand, 55190785 - 55190839
Alignment:
| Q |
137 |
gtgcataagggtgtgcaacaacatcgtatggaacataaggccatagctcaaccct |
191 |
Q |
| |
|
||||||| ||||||||||| || |||||||||||||| ||||||| |||| |||| |
|
|
| T |
55190785 |
gtgcatatgggtgtgcaacgacgtcgtatggaacatatggccatatctcagccct |
55190839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University