View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4631_high_7 (Length: 290)
Name: NF4631_high_7
Description: NF4631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4631_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 64 - 267
Target Start/End: Original strand, 24144534 - 24144735
Alignment:
| Q |
64 |
ttggtcaggctgtatgggagtgagcaagtttgtatgggagaagtttctcctttaatgtcctaactagaattggagacaacaccttctcaattcgatgaac |
163 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
24144534 |
ttggtcaggttgtatgggagtgagcaagtttgtatgggagaagtttctcctttaatgtcctaactagaattgga--ctacaccttctcaattcgatgaac |
24144631 |
T |
 |
| Q |
164 |
cttcgctaaaactcatttaactcccctcaagttacgagttgaggtacctatttgagagtttccattcttatgtataaattaaagatgatgttaacttgtg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||||| |
|
|
| T |
24144632 |
cttcgctaaaactcatttaactcccctcaagttacgagttgaggtacctatttgagagtttccattcatatgtataaattaaggatgatgctaacttgtg |
24144731 |
T |
 |
| Q |
264 |
ccct |
267 |
Q |
| |
|
|||| |
|
|
| T |
24144732 |
ccct |
24144735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 12 - 88
Target Start/End: Original strand, 23457395 - 23457471
Alignment:
| Q |
12 |
gtagattatactgcaacttatggaatgtgagttaactcacgtagaaggtattttggtcaggctgtatgggagtgagc |
88 |
Q |
| |
|
|||| ||||||| ||||||| ||||||||||||||||||| |||||||||||||| || | ||||||||||||| |
|
|
| T |
23457395 |
gtaggttatactccaacttaccaaatgtgagttaactcacgtggaaggtattttggtaagtttttatgggagtgagc |
23457471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 1505642 - 1505590
Alignment:
| Q |
17 |
ttatactgcaacttatggaatgtgagttaactcacgtagaaggtattttggtc |
69 |
Q |
| |
|
||||||| || ||||| |||||||||||||||||| | || |||||||||||| |
|
|
| T |
1505642 |
ttatacttcagcttatcgaatgtgagttaactcacatggagggtattttggtc |
1505590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 38 - 88
Target Start/End: Complemental strand, 7148360 - 7148310
Alignment:
| Q |
38 |
gtgagttaactcacgtagaaggtattttggtcaggctgtatgggagtgagc |
88 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
7148360 |
gtgagttaactcacgtagggagtattttggtcagtttgtatgggagtgagc |
7148310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 12 - 88
Target Start/End: Complemental strand, 25557940 - 25557864
Alignment:
| Q |
12 |
gtagattatactgcaacttatggaatgtgagttaactcacgtagaaggtattttggtcaggctgtatgggagtgagc |
88 |
Q |
| |
|
|||| ||||||| || |||| |||||||||||||| ||||| | ||||||||||||| ||||||||||||||| |
|
|
| T |
25557940 |
gtaggttatacttcatcttaccgaatgtgagttaacacacgtggggagtattttggtcagtttgtatgggagtgagc |
25557864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University