View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4631_low_13 (Length: 237)
Name: NF4631_low_13
Description: NF4631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4631_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 11 - 212
Target Start/End: Complemental strand, 27631817 - 27631617
Alignment:
| Q |
11 |
taatactcatataatattgacaagctaatgcttttttaagannnnnnnnnggatgaatgnnnnnnncgacgattccctacattcgttggatcatacattc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
27631817 |
taatactcatataatattgacaagctaatgcttttttaagatttttttt-ggatgaatgaaaaagacgacgattccctacattcgttggatcacacattc |
27631719 |
T |
 |
| Q |
111 |
acatatttaggacatcgacgatcactcgatcacaatcaaacgatcggaaaacttatctttattttttataattcaaaagcattaaggcttggagaaagaa |
210 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27631718 |
acatatttaggacatcgatgatcattcgatcacaatcaaacggtcggaaaacttatctttattttttataattcaaaagcattaaggcttggagaaagaa |
27631619 |
T |
 |
| Q |
211 |
ag |
212 |
Q |
| |
|
|| |
|
|
| T |
27631618 |
ag |
27631617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University