View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4631_low_16 (Length: 216)
Name: NF4631_low_16
Description: NF4631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4631_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 14 - 165
Target Start/End: Complemental strand, 6662050 - 6661899
Alignment:
| Q |
14 |
gcacagaaactaagaatgactaaagacttggggtgaatgactttaaaactacttctagaacttcaaaacataaaactttcacgtattaggatttgcgcac |
113 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
6662050 |
gcacagtaactaagaatgactaaagacttggggtgaatgactttaaaactacttctataacttcaaaacatgaaactttcacgtattagggtttgcgcac |
6661951 |
T |
 |
| Q |
114 |
acaaagtttcgaggattgtagagcatcttttttggactcatctcgatagcat |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6661950 |
acaaagtttcgaggattgtagagcatcttttttggactcatctcgctagcat |
6661899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 164 - 198
Target Start/End: Complemental strand, 6661876 - 6661842
Alignment:
| Q |
164 |
atccatgcagaattgggattaggttactttacaac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6661876 |
atccatgcagaattgggattaggttactttacaac |
6661842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University